ID: 1029973421_1029973427

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1029973421 1029973427
Species Human (GRCh38) Human (GRCh38)
Location 7:104811486-104811508 7:104811523-104811545
Sequence CCACCATGACTAGCTCTAAGTGA GTCAGTCAAGAGAGCAAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 204} {0: 1, 1: 0, 2: 2, 3: 20, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!