ID: 1029985159_1029985161

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1029985159 1029985161
Species Human (GRCh38) Human (GRCh38)
Location 7:104916291-104916313 7:104916304-104916326
Sequence CCAACAGGAGGATTTTTTGAGCC TTTTTGAGCCCATGAGGTCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 204, 3: 2287, 4: 10190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!