ID: 1029985159_1029985165

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1029985159 1029985165
Species Human (GRCh38) Human (GRCh38)
Location 7:104916291-104916313 7:104916344-104916366
Sequence CCAACAGGAGGATTTTTTGAGCC CTCACCACTGCACTCCAGGCTGG
Strand - +
Off-target summary No data {0: 28, 1: 2109, 2: 49635, 3: 151324, 4: 220334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!