ID: 1030002364_1030002366

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1030002364 1030002366
Species Human (GRCh38) Human (GRCh38)
Location 7:105079176-105079198 7:105079207-105079229
Sequence CCCAGGCTGGAATACAATGGCAC CTCATGTAACCTCCGTCTTCCGG
Strand - +
Off-target summary {0: 43, 1: 2178, 2: 28311, 3: 113281, 4: 200300} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!