ID: 1030002365_1030002366

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1030002365 1030002366
Species Human (GRCh38) Human (GRCh38)
Location 7:105079177-105079199 7:105079207-105079229
Sequence CCAGGCTGGAATACAATGGCACG CTCATGTAACCTCCGTCTTCCGG
Strand - +
Off-target summary {0: 15, 1: 1000, 2: 15290, 3: 76969, 4: 184841} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!