ID: 1030050020_1030050026

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1030050020 1030050026
Species Human (GRCh38) Human (GRCh38)
Location 7:105529676-105529698 7:105529713-105529735
Sequence CCAAAAATACAGTTAGGGGCCAG GGCTGTAATCCTAGCACTTTGGG
Strand - +
Off-target summary No data {0: 139, 1: 18607, 2: 254738, 3: 280632, 4: 171031}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!