ID: 1030079850_1030079858

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1030079850 1030079858
Species Human (GRCh38) Human (GRCh38)
Location 7:105767861-105767883 7:105767880-105767902
Sequence CCTTCTCCAGTCCACCCCTCTGG CTGGAGTTCGACTGGTACTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 437} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!