ID: 1030206300_1030206305

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1030206300 1030206305
Species Human (GRCh38) Human (GRCh38)
Location 7:106955368-106955390 7:106955394-106955416
Sequence CCTTGCCCCTTCTGTCATATGAG ACAGCAAGAAAGTGCCATCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!