ID: 1030286381_1030286388

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1030286381 1030286388
Species Human (GRCh38) Human (GRCh38)
Location 7:107831252-107831274 7:107831275-107831297
Sequence CCAGGTGGGCCATAAATGCCAAT CCTTATAAGAAGGAGGTGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 17, 3: 117, 4: 505}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!