ID: 1030356271_1030356273

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1030356271 1030356273
Species Human (GRCh38) Human (GRCh38)
Location 7:108546408-108546430 7:108546430-108546452
Sequence CCTGGAACAGGTGATATTTGAAC CTGGTTCTTCAGTGATACATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 49, 4: 322} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!