ID: 1030611301_1030611303

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1030611301 1030611303
Species Human (GRCh38) Human (GRCh38)
Location 7:111692405-111692427 7:111692426-111692448
Sequence CCTACGGCAGGAAGCACAGTCGA GAGCCACATGGAATCCAGACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 7, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!