ID: 1030855816_1030855819

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1030855816 1030855819
Species Human (GRCh38) Human (GRCh38)
Location 7:114555933-114555955 7:114555949-114555971
Sequence CCCTTGTCTTCTATACCTCCCTC CTCCCTCATCTCTACCTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 409} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!