|
Left Crispr |
Right Crispr |
Crispr ID |
1031390968 |
1031390973 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
7:121214333-121214355
|
7:121214374-121214396
|
Sequence |
CCCAGGCTAGAGTGTAGTGGTGC |
CCTCCGCCTCACAAGATCAAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 132, 1: 4907, 2: 59368, 3: 149412, 4: 213021} |
{0: 1, 1: 1, 2: 31, 3: 636, 4: 2258} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|