ID: 1031493657_1031493668 |
View in Genome Browser |
Spacer: 1 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1031493657 | 1031493668 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 7:122420881-122420903 | 7:122420905-122420927 |
Sequence | CCATACATTTAAGAAGAGATCCT | CTGGGGAAGGGGAGGGAGGATGG |
Strand | - | + |
Off-target summary | No data | {0: 2, 1: 4, 2: 73, 3: 556, 4: 4173} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |