ID: 1031493657_1031493668

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1031493657 1031493668
Species Human (GRCh38) Human (GRCh38)
Location 7:122420881-122420903 7:122420905-122420927
Sequence CCATACATTTAAGAAGAGATCCT CTGGGGAAGGGGAGGGAGGATGG
Strand - +
Off-target summary No data {0: 2, 1: 4, 2: 73, 3: 556, 4: 4173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!