ID: 1031713183_1031713192

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1031713183 1031713192
Species Human (GRCh38) Human (GRCh38)
Location 7:125075108-125075130 7:125075139-125075161
Sequence CCCACCCAAATCTCATGTCAAAT CCAGTGTTGAAAAGGGGGCCTGG
Strand - +
Off-target summary {0: 415, 1: 1612, 2: 3815, 3: 12769, 4: 13727} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!