ID: 1031832849_1031832853

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1031832849 1031832853
Species Human (GRCh38) Human (GRCh38)
Location 7:126648608-126648630 7:126648647-126648669
Sequence CCAAAAGGCAAATCTGGCTAATT GCATTTATGCTTTTGGATCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 219} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!