ID: 1031937519_1031937527

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1031937519 1031937527
Species Human (GRCh38) Human (GRCh38)
Location 7:127750939-127750961 7:127750987-127751009
Sequence CCCTTCCATTTAACCTAGTCTTC CTGTATCTTGTCTGTTTTGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!