ID: 1032027566_1032027579

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1032027566 1032027579
Species Human (GRCh38) Human (GRCh38)
Location 7:128455805-128455827 7:128455842-128455864
Sequence CCAGTGCGCGTGCGCGTACCCTC CGGCTATAAGGGGCGGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 27} {0: 1, 1: 0, 2: 0, 3: 15, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!