ID: 1032027572_1032027578

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1032027572 1032027578
Species Human (GRCh38) Human (GRCh38)
Location 7:128455824-128455846 7:128455838-128455860
Sequence CCTCCTGGGGCGTGCTCGCGGCT CTCGCGGCTATAAGGGGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 82} {0: 1, 1: 0, 2: 0, 3: 1, 4: 22}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!