ID: 1032049680_1032049694

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1032049680 1032049694
Species Human (GRCh38) Human (GRCh38)
Location 7:128640095-128640117 7:128640147-128640169
Sequence CCACCCCAGACTCCCAAGTAGCT CTGGCTAATGTTTCTTTTTTTGG
Strand - +
Off-target summary {0: 33, 1: 496, 2: 14727, 3: 30337, 4: 46849} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!