ID: 1032049687_1032049694

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1032049687 1032049694
Species Human (GRCh38) Human (GRCh38)
Location 7:128640107-128640129 7:128640147-128640169
Sequence CCCAAGTAGCTGGAACTACGGGT CTGGCTAATGTTTCTTTTTTTGG
Strand - +
Off-target summary {0: 25, 1: 987, 2: 20064, 3: 110438, 4: 252345} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!