ID: 1032049688_1032049694

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1032049688 1032049694
Species Human (GRCh38) Human (GRCh38)
Location 7:128640108-128640130 7:128640147-128640169
Sequence CCAAGTAGCTGGAACTACGGGTG CTGGCTAATGTTTCTTTTTTTGG
Strand - +
Off-target summary {0: 29, 1: 1597, 2: 33463, 3: 109179, 4: 135297} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!