ID: 1032073390_1032073395

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1032073390 1032073395
Species Human (GRCh38) Human (GRCh38)
Location 7:128823808-128823830 7:128823833-128823855
Sequence CCGGGGACCGGTTTCATGGAAGA ATTTTTCCACAGATGGAGAGGGG
Strand - +
Off-target summary {0: 80, 1: 787, 2: 1189, 3: 1471, 4: 1184} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!