ID: 1032073391_1032073395

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1032073391 1032073395
Species Human (GRCh38) Human (GRCh38)
Location 7:128823815-128823837 7:128823833-128823855
Sequence CCGGTTTCATGGAAGACAATTTT ATTTTTCCACAGATGGAGAGGGG
Strand - +
Off-target summary {0: 366, 1: 675, 2: 884, 3: 752, 4: 745} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!