ID: 1032080738_1032080749

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1032080738 1032080749
Species Human (GRCh38) Human (GRCh38)
Location 7:128857258-128857280 7:128857302-128857324
Sequence CCTGGCAACTACCTCATTGCCAT CATCGTGGGCAGCCCCTTCAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 11, 4: 148} {0: 2, 1: 1, 2: 1, 3: 14, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!