ID: 1032080740_1032080750

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1032080740 1032080750
Species Human (GRCh38) Human (GRCh38)
Location 7:128857269-128857291 7:128857308-128857330
Sequence CCTCATTGCCATCAAGTACGGTG GGGCAGCCCCTTCAAGGCCAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 50} {0: 2, 1: 1, 2: 6, 3: 31, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!