ID: 1032080742_1032080756

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1032080742 1032080756
Species Human (GRCh38) Human (GRCh38)
Location 7:128857277-128857299 7:128857330-128857352
Sequence CCATCAAGTACGGTGGCCCCCAG GTCACTGGTGAGTGCCAGTTTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 76} {0: 1, 1: 1, 2: 2, 3: 7, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!