ID: 1032081285_1032081298

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1032081285 1032081298
Species Human (GRCh38) Human (GRCh38)
Location 7:128859767-128859789 7:128859814-128859836
Sequence CCTCCTGAACTCCTGCAACAGCC CTCCCCTCCATGCTGCAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 295} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!