ID: 1032081285_1032081305

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1032081285 1032081305
Species Human (GRCh38) Human (GRCh38)
Location 7:128859767-128859789 7:128859820-128859842
Sequence CCTCCTGAACTCCTGCAACAGCC TCCATGCTGCAGCTTGGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 295} {0: 1, 1: 0, 2: 0, 3: 24, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!