ID: 1032081289_1032081307

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1032081289 1032081307
Species Human (GRCh38) Human (GRCh38)
Location 7:128859788-128859810 7:128859821-128859843
Sequence CCCTGCCCTGGCCAGCTCCCTCC CCATGCTGCAGCTTGGCGGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 129, 4: 989} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!