ID: 1032446796_1032446801

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1032446796 1032446801
Species Human (GRCh38) Human (GRCh38)
Location 7:131991157-131991179 7:131991186-131991208
Sequence CCAGAGAGATTCGTTCTGTTTGC TAGGTTCACCACAGGGAGGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!