ID: 1032492193_1032492197

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1032492193 1032492197
Species Human (GRCh38) Human (GRCh38)
Location 7:132331935-132331957 7:132331951-132331973
Sequence CCTAGACCCTGCTCAGATAAGGC ATAAGGCATCTGGACAACCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 152} {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!