ID: 1032662048_1032662050

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1032662048 1032662050
Species Human (GRCh38) Human (GRCh38)
Location 7:133994977-133994999 7:133994994-133995016
Sequence CCTGAGGAGTTCACAAGCCAACT CCAACTTTCTAGTAGAGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 118} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!