ID: 1032841173_1032841186

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1032841173 1032841186
Species Human (GRCh38) Human (GRCh38)
Location 7:135714601-135714623 7:135714640-135714662
Sequence CCCACATGCCCACGGGCCCGCAT CCTCCATGGCGAGGAGAGATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 14, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!