ID: 1033185542_1033185547

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1033185542 1033185547
Species Human (GRCh38) Human (GRCh38)
Location 7:139224890-139224912 7:139224939-139224961
Sequence CCTTCTTCGGTCTCCCTCTGTTG TCGCTGCAACCTCCCTGCCTCGG
Strand - +
Off-target summary {0: 4, 1: 1, 2: 8, 3: 113, 4: 225} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!