ID: 1033242435_1033242439

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1033242435 1033242439
Species Human (GRCh38) Human (GRCh38)
Location 7:139691165-139691187 7:139691196-139691218
Sequence CCCTTACTATCACAGTGTGGTAT TATGTGGCTAGCTGCAGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 124} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!