ID: 1033256948_1033256954

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1033256948 1033256954
Species Human (GRCh38) Human (GRCh38)
Location 7:139809753-139809775 7:139809786-139809808
Sequence CCTTTTTGTTCTATCCAGGTCCA GGTGGTGCCCGTCCATGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 45, 3: 233, 4: 718} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!