ID: 1033285405_1033285411

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1033285405 1033285411
Species Human (GRCh38) Human (GRCh38)
Location 7:140037001-140037023 7:140037025-140037047
Sequence CCCATCAACTCCAAAGTCGCCTA AGAAAAGATGGCAGCAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 69} {0: 1, 1: 0, 2: 9, 3: 64, 4: 652}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!