ID: 1033285405_1033285412

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1033285405 1033285412
Species Human (GRCh38) Human (GRCh38)
Location 7:140037001-140037023 7:140037030-140037052
Sequence CCCATCAACTCCAAAGTCGCCTA AGATGGCAGCAGGCCAGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 69} {0: 1, 1: 0, 2: 11, 3: 115, 4: 1052}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!