ID: 1033542479_1033542489

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1033542479 1033542489
Species Human (GRCh38) Human (GRCh38)
Location 7:142369631-142369653 7:142369662-142369684
Sequence CCAAATGCACAGACTGTCTCTCC TGGCCACTGCCAGGGGATGGGGG
Strand - +
Off-target summary No data {0: 6, 1: 16, 2: 55, 3: 130, 4: 717}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!