ID: 1033692154_1033692159

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1033692154 1033692159
Species Human (GRCh38) Human (GRCh38)
Location 7:143747225-143747247 7:143747273-143747295
Sequence CCAGTTCAATCACAGCCATTCAC TCAGAGAAATGAACATGAGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!