ID: 1033759015_1033759018

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1033759015 1033759018
Species Human (GRCh38) Human (GRCh38)
Location 7:144420852-144420874 7:144420868-144420890
Sequence CCTAGATCTTGGGCCAGTGCCTG GTGCCTGACCAAACATATGAGGG
Strand - +
Off-target summary {0: 90, 1: 71, 2: 21, 3: 37, 4: 362} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!