ID: 1033845927_1033845932 |
View in Genome Browser |
Spacer: 17 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1033845927 | 1033845932 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 7:145432111-145432133 | 7:145432151-145432173 |
Sequence | CCTAATTTCAATATTGTTGCATC | CTGAGGAGAAGGAGAGATGAGGG |
Strand | - | + |
Off-target summary | {0: 10, 1: 55, 2: 335, 3: 638, 4: 817} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |