ID: 1034010133_1034010139

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1034010133 1034010139
Species Human (GRCh38) Human (GRCh38)
Location 7:147520839-147520861 7:147520877-147520899
Sequence CCCATGCTCAGCTTCCGTAGACC CAGTCACTTCATTTACCCCTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 14, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!