ID: 1034089730_1034089737

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1034089730 1034089737
Species Human (GRCh38) Human (GRCh38)
Location 7:148352673-148352695 7:148352694-148352716
Sequence CCCTTGTGCTGCAGGTGGAGAAA AACTGATGGTAGGAGTATGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 280} {0: 1, 1: 0, 2: 1, 3: 7, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!