ID: 1034147308_1034147324

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1034147308 1034147324
Species Human (GRCh38) Human (GRCh38)
Location 7:148884393-148884415 7:148884443-148884465
Sequence CCCGCCGGGCTCGGAGGCGCCGA GCTCGTGGGCGGGCGGGCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 109} {0: 1, 1: 0, 2: 0, 3: 10, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!