|
Left Crispr |
Right Crispr |
| Crispr ID |
1034219807 |
1034219808 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:149435169-149435191
|
7:149435194-149435216
|
| Sequence |
CCATATATGTACATATTTTTGAG |
AGTGTCTTGCTCTGTCACCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 0, 2: 5, 3: 74, 4: 696} |
{0: 293, 1: 14401, 2: 50532, 3: 112523, 4: 166340} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|