ID: 1034235980_1034235995

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1034235980 1034235995
Species Human (GRCh38) Human (GRCh38)
Location 7:149569860-149569882 7:149569913-149569935
Sequence CCGTCTTCTCAGGGGAAGAAAGA TAGCGGGAGGGGAAGGAGAGAGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 3, 3: 50, 4: 377} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!