ID: 1034235984_1034235996

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1034235984 1034235996
Species Human (GRCh38) Human (GRCh38)
Location 7:149569897-149569919 7:149569929-149569951
Sequence CCCGCCAGCCACTCCCTAGCGGG AGAGAGGAGAACAGCAGTGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 6, 3: 49, 4: 456}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!