ID: 1034275976_1034275984

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1034275976 1034275984
Species Human (GRCh38) Human (GRCh38)
Location 7:149824034-149824056 7:149824073-149824095
Sequence CCTGGACTGGGTCCTGCCTCCCT CCCCCTCCCACAGTGAATGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 48, 4: 539} {0: 1, 1: 0, 2: 2, 3: 21, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!